How to use from the
Use from the
Transformers library
# Use a pipeline as a high-level helper
from transformers import pipeline

pipe = pipeline("text-classification", model="duttaprat/HViLM-R0", trust_remote_code=True)
# Load model directly
from transformers import AutoModelForSequenceClassification
model = AutoModelForSequenceClassification.from_pretrained("duttaprat/HViLM-R0", trust_remote_code=True, device_map="auto")
Quick Links

HViLM-R0

HViLM-R0 is the official HViLM model for binary virus transmissibility classification using the threshold R₀ < 1 versus R₀ ≥ 1.

  • Fine-tuned from: duttaprat/HViLM-base
  • Benchmark: duttaprat/HVUE-v2
  • HVUE v2 configuration: Transmissibility/standard_capped_1000bp
  • Checkpoint selection: best validation F1 (checkpoint-21000)
  • Input: virus nucleotide sequence
  • Output: R₀ < 1 vs. R₀ ≥ 1 class

This repository contains a standalone full fine-tuned checkpoint, so users can load duttaprat/HViLM-R0 directly without separately loading HViLM-base.

Label Mapping

ID Label
0 R0_LT_1
1 R0_GE_1

Performance

Held-out HVUE v2 test set, standard 1000-nt configuration:

Metric Score
Accuracy 87.50
F1 86.16
MCC 72.66
Precision 86.79
Recall 85.64

Training Details

  • Fine-tuning method: LoRA
  • LoRA rank: 8
  • LoRA alpha: 16
  • Target modules: query and value projections across all 12 transformer layers
  • Approximate trainable LoRA parameters: ~0.3M
  • Learning rate: 3e-5
  • Maximum input length: 250 BPE tokens (approximately 1000 nt)
  • Early stopping: patience 3, monitored using validation F1
  • Hardware: NVIDIA A40 GPU

The released repository contains the full task-specific model weights rather than only the LoRA adapter.

Usage

import torch
from transformers import AutoTokenizer, AutoModelForSequenceClassification

model_id = "duttaprat/HViLM-R0"

tokenizer = AutoTokenizer.from_pretrained(model_id, trust_remote_code=True)
model = AutoModelForSequenceClassification.from_pretrained(
    model_id,
    trust_remote_code=True,
)

sequence = "ATGCGTACGTTAGCCGATCGATTACGCGTACGTAGCTAGC"
inputs = tokenizer(
    sequence,
    return_tensors="pt",
    truncation=True,
    max_length=250,
)

with torch.no_grad():
    logits = model(**inputs).logits

prediction_id = logits.argmax(dim=-1).item()
print(model.config.id2label[prediction_id])

Possible outputs are R0_LT_1 and R0_GE_1.

Intended Use

HViLM-R0 is intended for research and benchmarking of sequence-based transmissibility classification. The benchmark classes should not be interpreted as direct estimates of a virus's reproduction number in a specific population or outbreak.

Related Resources

Citation

@article{dutta2026hvilm,
  title={HViLM: A foundation model for viral genomics enables multi-task prediction of pathogenicity, transmissibility, and host tropism},
  author={Dutta, Pratik and Vaska, Jack and Surana, Pallavi and Sathian, Rekha and Chao, Max and Zhou, Zhihan and Liu, Han and Davuluri, Ramana V},
  journal={bioRxiv},
  pages={2026--03},
  year={2026},
  publisher={Cold Spring Harbor Laboratory}
}
Downloads last month
19
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support

Model tree for duttaprat/HViLM-R0

Finetuned
(3)
this model

Dataset used to train duttaprat/HViLM-R0

Collection including duttaprat/HViLM-R0